Lodderomyces elongisporus (Recca et Mrak) van der Walt, teleomorph (ATCC® 11503™)

Alternate State: Candida parapsilosis (Ashford) Langeron et Talice, anamorph  /  Strain Designations: 78 [CBS 2605, CCRC 21390, DBVPG 6183, IFO 1676, JCM 1781, NRRL YB-4239]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Saccharomyces elongisporus Recca et Mrak, teleomorph
Strain Designations 78 [CBS 2605, CCRC 21390, DBVPG 6183, IFO 1676, JCM 1781, NRRL YB-4239]
Alternate State Candida parapsilosis (Ashford) Langeron et Talice, anamorph
Biosafety Level 1
Product Format freeze-dried
Type Strain yes (type strain)
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ATTGATATGCTTAAGTTCAGCGGGTAATCCTACCTGATTTGAGGTCGAAGTTTGAAATATAGATTGGAGCTTTTTATTAAGCACAATGGAGTGGTTAGACCTAATACATTGTTATAAATACTCCTCCTAACTTTCAAGCAAACCTGGCGTATTGCTCATCACCAAACCCGGGGGTTTGAGGGAGAAATGACGCTCAAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAATATCTGCAATTCATATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGACTATTAATAAATATAATCAGTTGACTAGTTTAAAATAAAAAATTTAGGTTGAGTTTATCCTCTGGCAGCAGAGCAATTAAGCAGCCACTGCCAAAGCAAGTTTTAAGAATAAAACAAAAACACGTGTGTAGATAAGAAAAGTGCAGTTAAGCACAATTCTCAAAA
Name of Depositor JA Recca
Isolation
Concentrated orange juice, California
Cross References

Nucleotide (GenBank) : HQ876050 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ876042 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : HQ876033 18S rRNA gene

References

van der Walt JP. Lodderomyces, a new genus of the Saccharomycetaceae. Antonie van Leeuwenhoek 32: 1-5, 1966. PubMed: 5296604

type strain

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

type strain

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS